EnhancerDB
  1. Home
  2. Gene
  3. AMT[ENSG00000145020.10]
Enhancers that regulate AMT[ENSG00000145020.10]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr3 49368585 49372735 enh48691 49460186 87451
Thymus Stomach
chr3 49379445 49392755 enh7203 49460186 67431
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Uterus Stomach Skin (Keratinocyte) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1)
chr3 49382516 49382833 vista40877 49460186 77353
VISTA
chr3 49389809 49389972 vista40878 49460186 70214
VISTA
chr3 49413089 49419555 enh20585 49460186 40631
Prostate (PC-3) Esophagus Astrocyte Blood (GM12878) Placenta Colon (HCT116) Muscle (Myoblast)
chr3 49419751 49431500 enh63137 49460186 28686
Esophagus Prostate (PC-3) Cervix (HeLa-S3) Colon (HCT116)
chr3 49425171 49425361 vista40879 49460186 34825
VISTA
chr3 49432126 49441591 enh35394 49460186 18595
Bone Marrow (K562) Astrocyte Stomach Muscle (A673) Colon (HCT116) Thyroid Uterus Heart
chr3 49444905 49449295 enh100022 49460186 10891
Uterus
chr3 49479245 49501124 enh7204 49460186 19059
Bone Marrow (K562) Brain (SK-N-MC) Colon (HCT116) Blood (Karpas-422) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Ovary Bone (Osteoblast) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Heart
chr3 49503154 49503264 vista40880 49460186 42968
VISTA
chr3 49518245 49524115 enh20586 49460186 58059
Liver (HepG2) Colon (HCT116) Placenta Neural Stem Cells (H9) Heart
chr3 49529405 49541046 enh20587 49460186 69219
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Stomach Placenta Colon (HCT116) Breast Thyroid Pancreas Spleen Muscle (Myotube) Uterus Thymus Heart
chr3 49545745 49553515 enh20588 49460186 85559
Stomach Placenta Lung (PC-9) Epithelial (MCF-7)
chr3 49553545 49563819 enh20589 49460186 93359
Skin (Keratinocyte) Liver (HepG2) Prostate (RWPE1) Esophagus Liver Placenta Breast Pancreas Muscle (Myotube) Thymus Stomach
Transcript facotrs that regulate AMT[ENSG00000145020.10]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with AMT[ENSG00000145020.10], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr3 49436584 rs9861027 C T 17627 Esophagus 1.82598e-44 6725557
chr3 49436584 rs9861027 C T 17627 Esophagus 3.57666e-15 6725557
chr3 49436584 rs9861027 C T 17627 Esophagus 5.36587e-41 6725557
chr3 49488984 rs4855869 T A,C 28798 Heart 0.0605185 6725800
chr3 49436584 rs9861027 C T 17627 Spleen 1.15211e-15 6725557
chr3 49438803 rs7648995 C T 15408 Uterus 0.14499 6725591
chr3 49480908 rs9654010 T C 20722 Thyroid 5.27877e-70 6725735
chr3 49423141 rs796782674 GT G 31070 Lung 1.38965e-49 6725397
chr3 49537486 rs142095221 TAGCCTCCGCTTCCCGGGTTCAAGCAATTTTCCTGTCTC T 77300 Adrenal 0.370114 6726056
Details of AMT[ENSG00000145020.10]
Back to top
Genomic Location chr3:49454211-49460186[-]
TSS 49460186
Gene Name AMT
Ensembl ID ENSG00000145020.10
ENTREZID 275
Uniprot
P48728
A0A024R2U7
Protein Name
mitochondrial
AMT protein
Aminomethyltransferase
Aminomethyltransferase
Expression levels of AMT[ENSG00000145020.10]
Back to top