EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr19:2487661-2489954]
Chromosome characteristics of TCF7L2[chr19:2487661-2489954]
Back to top
Enhancers possibly regulated by TCF7L2[chr19:2487661-2489954]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2481141 2509475 enh4958
Bone Marrow (K562) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr19 2489253 2489454 vista28221
VISTA
SNP sites on TCF7L2[chr19:2487661-2489954]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2487736 rs188083353 C T 5384708
chr19 2487746 rs7250125 G A 5384709
chr19 2487791 rs185447108 T C 5384710
chr19 2487792 rs115503045 G C 5384711
chr19 2487858 rs4806857 A G 5384712
chr19 2487882 rs182023254 T C 5384713
chr19 2488004 rs146307675 G A 5384714
chr19 2488090 rs12327669 G A 5384715
chr19 2488097 rs541165384 T G 5384716
chr19 2488144 rs11668293 G C 5384717
chr19 2488150 rs117027567 C G,T 5384718
chr19 2488172 rs10420027 C A 5384719
chr19 2488215 rs7253793 G A 5384720
chr19 2488299 rs10418709 G C 5384721
chr19 2488318 rs7253938 G T 5384722
chr19 2488402 rs79180974 G C 5384723
chr19 2488519 rs118068817 T G 5384724
chr19 2488675 rs148517711 C T 5384725
chr19 2488725 rs561152372 T C 5384726
chr19 2488732 rs34663232 A C 5384727
chr19 2488747 rs141777011 C A 5384728
chr19 2488754 rs150601333 C T 5384729
chr19 2488766 rs11879993 G A 5384730
chr19 2488786 rs34243951 A G 5384731
chr19 2488830 rs370091225 C A 5384732
chr19 2488882 rs116951153 G A,T 5384733
chr19 2488914 rs567643332 C A,T 5384734
chr19 2489063 rs12986362 C T 5384735
chr19 2489111 rs539171782 C A 5384736
chr19 2489189 rs557165931 G T 5384737
chr19 2489362 rs553830828 TCGGGCACTGCGCCAGGGCC T 5384738
chr19 2489381 rs540484738 C T 5384739
chr19 2489423 rs186928258 C T 5384740
chr19 2489445 rs147785722 T C 5384741
chr19 2489485 rs139580022 C T 5384742
chr19 2489501 rs117513125 T C 5384743
chr19 2489532 rs12985828 G A 5384744
chr19 2489541 rs534990505 T G 5384745
chr19 2489560 rs75603520 C G 5384746
chr19 2489650 rs79746087 T C 5384747
chr19 2489717 rs114419133 C T 5384748
chr19 2489764 rs76844220 G A,C,T 5384749
chr19 2489781 rs144884636 C T 5384750
chr19 2489791 rs540572582 T C 5384751
Genes possibly regulated by TCF7L2[chr19:2487661-2489954]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr19:2487661-2489954]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results