EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr6:29933639-29934415]
Chromosome characteristics of TCF7L2[chr6:29933639-29934415]
Back to top
Enhancers possibly regulated by TCF7L2[chr6:29933639-29934415]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 29930235 29938316 enh9028
Liver Astrocyte Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Pancreas (Panc1) Neural Stem Cells (H9) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr6 29933738 29934144 vista51501
VISTA
SNP sites on TCF7L2[chr6:29933639-29934415]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 29933648 rs7755763 A T 8944587
chr6 29933654 rs6919102 C G 8944588
chr6 29933878 rs187649478 T C 8944589
chr6 29933881 rs6457110 T A 8944590
chr6 29933895 rs576635654 G C 8944591
chr6 29933925 rs561734040 C T 8944592
chr6 29933943 rs77321096 A C 8944593
chr6 29933945 rs541005547 A C 8944594
chr6 29933947 rs564022765 A C 8944595
chr6 29933954 rs369678743 A G 8944596
chr6 29933964 rs7769998 G C,T 8944597
chr6 29934022 rs6914699 T C 8944598
chr6 29934080 rs6935024 C T 8944599
chr6 29934109 rs2571405 A G 8944600
chr6 29934130 rs60244151 G GT 8944601
chr6 29934131 rs9260746 A T 8944602
chr6 29934140 rs547812713 G A 8944603
chr6 29934151 rs6935189 C G 8944604
chr6 29934152 rs17180058 C G 8944605
chr6 29934154 rs6935198 C G 8944606
chr6 29934160 rs17180072 G A 8944607
chr6 29934163 rs6935053 A C 8944608
chr6 29934170 rs6914900 T G 8944609
chr6 29934201 rs114873939 G A 8944610
chr6 29934291 rs17186468 A C 8944611
chr6 29934319 rs76350511 GTCATCCTGAGTAATAAATGGTA G 8944612
chr6 29934348 rs17186475 A C 8944613
Genes possibly regulated by TCF7L2[chr6:29933639-29934415]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr6:29933639-29934415]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results