EnhancerDB
  1. Home
  2. TFBS
  3. TAF1[chr11:62211980-62212290]
Chromosome characteristics of TAF1[chr11:62211980-62212290]
Back to top
Enhancers possibly regulated by TAF1[chr11:62211980-62212290]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 62190145 62243455 enh13972
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Placenta Lung (PC-9) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr11 62211626 62212261 vista10494
VISTA
SNP sites on TAF1[chr11:62211980-62212290]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 62212002 rs546882660 G A 2031337
chr11 62212013 rs7942143 G C,T 2031338
chr11 62212021 rs2513065 G A 2031339
chr11 62212043 rs2509988 C T 2031340
chr11 62212090 rs2509987 C G 2031341
chr11 62212193 rs540629473 TGCGTCAGCTGATTACCTGATTTCATCTG T 2031342
chr11 62212290 rs557078357 G C 2031343
Genes possibly regulated by TAF1[chr11:62211980-62212290]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TAF1[chr11:62211980-62212290]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results