EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:11383408-11385656]
Chromosome characteristics of ZNF143[chr16:11383408-11385656]
Back to top
Enhancers possibly regulated by ZNF143[chr16:11383408-11385656]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 11382725 11409295 enh3884
Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Stomach Epithelial (MCF-7) Skin (Keratinocyte) Brain (SK-N-SH) Blood (OCI-LY7) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Blood (GM12878) Placenta Lung (PC-9) Spleen Muscle (Myotube) Liver (HepG2) Muscle (A673)
chr16 11384330 11384439 vista21854
VISTA
SNP sites on ZNF143[chr16:11383408-11385656]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 11383429 rs138462967 T C 4316413
chr16 11383436 rs58137497 A G 4316414
chr16 11383519 rs4451969 T C 4316415
chr16 11383539 rs539102627 G A 4316416
chr16 11383591 rs191032093 A G 4316417
chr16 11383704 rs143044633 A T 4316418
chr16 11383710 rs572531213 G A 4316419
chr16 11383747 rs76870768 C G,T 4316420
chr16 11383816 rs531526124 C T 4316421
chr16 11383869 rs373839227 A T 4316422
chr16 11383896 rs75819382 C T 4316423
chr16 11383908 rs547081539 C T 4316424
chr16 11384129 rs181225232 G A 4316425
chr16 11384136 rs59954524 T C 4316426
chr16 11384142 rs112804891 G A 4316427
chr16 11384164 rs80292096 A G 4316428
chr16 11384169 rs558266365 G A 4316429
chr16 11384253 rs545627214 ATGGGGTGGGGACAAGGGGGGAACAAGGGGAACCC A 4316430
chr16 11384269 rs111274070 G C 4316431
chr16 11384328 rs149693355 C T 4316432
chr16 11384396 rs375024921 AG A 4316433
chr16 11384396 rs950468727 AG A 4316434
chr16 11384553 rs28493784 G A 4316435
chr16 11384741 rs243316 T C 4316436
chr16 11384776 rs8054781 T C 4316437
chr16 11384829 rs181694 C T 4316438
chr16 11384956 rs9673543 A G 4316439
chr16 11385011 rs243315 C T 4316440
chr16 11385025 rs28465461 C G 4316441
chr16 11385031 rs142494546 C A 4316442
chr16 11385104 rs243314 G C 4316443
chr16 11385134 rs142308281 C T 4316444
chr16 11385229 rs115291575 G A 4316445
chr16 11385329 rs11647972 C T 4316446
chr16 11385396 rs144508467 G A 4316447
chr16 11385514 rs111257175 C T 4316448
chr16 11385538 rs7196882 C G,T 4316449
chr16 11385570 rs75012323 C G 4316450
Genes possibly regulated by ZNF143[chr16:11383408-11385656]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:11383408-11385656]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results