EnhancerDB
  1. Home
  2. Gene
  3. S100A13[ENSG00000189171.9]
Enhancers that regulate S100A13[ENSG00000189171.9]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr1 153502645 153506875 enh47239 153606568 99693
Muscle (A673) Thymus
chr1 153510895 153511054 vista3340 153606568 95514
VISTA
chr1 153515225 153519715 enh74378 153606568 86853
Muscle (A673) Uterus
chr1 153525322 153525412 vista3341 153606568 81156
VISTA
chr1 153526279 153526545 vista3342 153606568 80023
VISTA
chr1 153541018 153541368 vista3343 153606568 65200
VISTA
chr1 153545866 153546049 vista3344 153606568 60519
VISTA
chr1 153548105 153553735 enh12270 153606568 52833
Skin (Keratinocyte) Cervix (HeLa-S3) Esophagus Bone (Osteoblast) Placenta Colon (HCT116) Muscle (Myotube)
chr1 153549643 153549828 vista3345 153606568 56740
VISTA
chr1 153558585 153562735 enh12271 153606568 43833
Placenta
chr1 153563285 153567435 enh109353 153606568 39133
Stomach
chr1 153567604 153573987 enh628 153606568 32581
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Colon (HCT116) Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Neural Stem Cells (H9) Thymus Stomach
chr1 153579201 153583975 enh12272 153606568 22593
Placenta Bone (Osteoblast)
chr1 153583449 153583810 vista3346 153606568 22758
VISTA
chr1 153584539 153584862 vista3347 153606568 21706
VISTA
chr1 153616165 153624748 enh12273 153606568 9597
Bone Marrow (K562) Blood (T-cell) Placenta Colon (HCT116) Pancreas Muscle (Myotube) Thymus
chr1 153667305 153673887 enh12274 153606568 60737
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Ovary Esophagus Bone (Osteoblast) Stomach Placenta Uterus Lung (PC-9) Pancreas Muscle (Myotube) Neural Stem Cells (H9) Heart
chr1 153670755 153671012 vista3348 153606568 64187
VISTA
chr1 153671679 153672046 vista3349 153606568 65111
VISTA
chr1 153676065 153683955 enh12275 153606568 69497
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Placenta Colon (HCT116) Epithelial (MCF-7)
chr1 153697963 153709075 enh61908 153606568 91395
Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Esophagus Thyroid Colon (HCT116) Lung (PC-9) Stomach
chr1 153702935 153703414 vista3350 153606568 96367
VISTA
chr1 153704694 153704943 vista3351 153606568 98126
VISTA
Transcript facotrs that regulate S100A13[ENSG00000189171.9]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
SNPs associated with S100A13[ENSG00000189171.9], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr1 153622220 rs913861 G A,T 15652 Esophagus 0.00153285 635601
chr1 153565636 rs2026564 A G 25627 Heart 1.82795e-11 635254
chr1 153607075 rs56011347 G GACAGGGCTTTGAGGATGGTAGGGAGATTAAGAAGT 507 Breast 0.00786306 635515
chr1 153590254 rs9330298 C A 1009 Liver 0.0101373 635450
chr1 153706589 rs112607524 G T 100021 Stomach 0.427504 636070
chr1 153560040 rs28857273 C A 31223 Adrenal 3.64246e-11 635211
Details of S100A13[ENSG00000189171.9]
Back to top
Genomic Location chr1:153591263-153606568[-]
TSS 153606568
Gene Name S100A13
Ensembl ID ENSG00000189171.9
ENTREZID 6284
Uniprot
Q99584
Protein Name
isoform CRA_a
Protein S100-A13
S100 calcium binding protein A13
Expression levels of S100A13[ENSG00000189171.9]
Back to top