EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr1:19277822-19279058]
Chromosome characteristics of ZZZ3[chr1:19277822-19279058]
Back to top
Enhancers possibly regulated by ZZZ3[chr1:19277822-19279058]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 19252691 19280920 enh11566
Brain (SK-N-MC) Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Kidney Stomach Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Prostate (PC-3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr1 19278388 19278892 vista599
VISTA
SNP sites on ZZZ3[chr1:19277822-19279058]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 19277929 rs146905845 G C 128419
chr1 19277942 rs78244405 A T 128420
chr1 19278010 rs75028091 G A 128421
chr1 19278097 rs544519900 TCTACCAGCCCAGGGCAACTTCCC T 128422
chr1 19278231 rs188676325 C T 128423
chr1 19278332 rs191021519 G A,C 128424
chr1 19278333 rs182583374 C A 128425
chr1 19278635 rs28452849 C T 128426
chr1 19278705 rs540268063 T C 128427
chr1 19278960 rs191204462 C A 128428
chr1 19279048 rs28422004 A G 128429
Genes possibly regulated by ZZZ3[chr1:19277822-19279058]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 19230775 19283180 - IFFO2 ENSG00000169991.6 19283180 0.83 0.99 4122 255
Expression level of Genes
Back to top
miRNAs possibly regulated by ZZZ3[chr1:19277822-19279058]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results