EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:48288340-48288761]
Chromosome characteristics of ZNF143[chr17:48288340-48288761]
Back to top
Enhancers possibly regulated by ZNF143[chr17:48288340-48288761]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 48279381 48302635 enh17216
Bone Marrow (K562) Liver Astrocyte Embryonic Stem Cell Line (H1-hESC) Uterus Kidney Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Lung (A549) Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Breast Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673) Heart
chr17 48288364 48288588 vista25105
VISTA
SNP sites on ZNF143[chr17:48288340-48288761]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48288359 rs561765530 C T 4921626
chr17 48288396 rs2246839 G A 4921627
chr17 48288404 rs145611811 C A,T 4921628
chr17 48288459 rs118083201 C T 4921629
chr17 48288462 rs78516251 C A,G 4921630
chr17 48288474 rs536170360 C T 4921631
chr17 48288559 rs548238108 G C 4921632
chr17 48288613 rs532196975 T TTCACTCCCCACCAATGAGCCTCAGTTTCCTCAAC 4921633
Genes possibly regulated by ZNF143[chr17:48288340-48288761]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:48288340-48288761]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results