Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 48288396 rs2246839 G A 4921627
chr17 48288404 rs145611811 C A,T 4921628
chr17 48288459 rs118083201 C T 4921629
chr17 48288462 rs78516251 C A,G 4921630
chr17 48288474 rs536170360 C T 4921631
chr17 48288559 rs548238108 G C 4921632
chr17 48288613 rs532196975 T TTCACTCCCCACCAATGAGCCTCAGTTTCCTCAAC 4921633

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results