EnhancerDB
  1. Home
  2. Gene
  3. NAGLU[ENSG00000108784.5]
Enhancers that regulate NAGLU[ENSG00000108784.5]
Back to top
Chrom. Start End Enhancer ID TSS of gene Distance between enhancer and TSS Tissues that enhancer appears More
chr17 40578365 40596495 enh17162 40688190 91695
Liver (HepG2) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Bone (Osteoblast) Blood (OCI-LY7) Stomach Placenta Colon (HCT116) Peripheral Blood (MM.1S) Lung (PC-9) Muscle (Myotube) Uterus Epithelial (MCF-7)
chr17 40597265 40601415 enh108668 40688190 86775
Lung (PC-9)
chr17 40608913 40609089 vista24821 40688190 79101
VISTA
chr17 40613314 40618314 enh52501 40688190 69876
Liver (HepG2) Large Intestine Lung (A549)
chr17 40623105 40629415 enh104326 40688190 58775
Peripheral Blood (MM.1S) Stomach
chr17 40628029 40628344 vista24822 40688190 59846
VISTA
chr17 40666365 40672295 enh17163 40688190 15895
Bone Marrow (K562) Skin (Keratinocyte) Cervix (HeLa-S3) Brain (SK-N-SH) Brain (SK-N-MC) Large Intestine Ovary Esophagus Bone (Osteoblast) Muscle (A673) Placenta Lung (PC-9) Pancreas Uterus Thymus Kidney
chr17 40670495 40670831 vista24823 40688190 17359
VISTA
chr17 40671173 40671319 vista24824 40688190 16871
VISTA
chr17 40672425 40682855 enh17164 40688190 5335
Bone Marrow (K562) Liver (HepG2) Prostate (RWPE1) Ovary Esophagus Astrocyte Bone (Osteoblast) Lung (A549) Stomach Placenta Pancreas Spleen Uterus Heart
chr17 40689876 40689925 vista24825 40688190 1686
VISTA
chr17 40748943 40749226 vista24826 40688190 60753
VISTA
chr17 40749080 40753250 enh102567 40688190 60890
Bone (Osteoblast)
chr17 40767925 40773235 enh48036 40688190 79735
Bone Marrow (K562) Cervix (HeLa-S3) Brain (SK-N-SH) Prostate (RWPE1) Esophagus Blood (OCI-LY7) Peripheral Blood (MM.1S) Lung (PC-9) Pancreas Pancreas (Panc1) Neural Stem Cells (H9) Thymus Heart
chr17 40774039 40787155 enh17165 40688190 85849
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Stomach Placenta Lung (PC-9) Pancreas Epithelial (MCF-7)
Transcript facotrs that regulate NAGLU[ENSG00000108784.5]
Back to top
Chrom. Start End TF name Source Predicted site? Tissue TSS of gene Distance between TFBS and gene id More
chr17 40682683 40683227 ZNF274 ENCODE Uniform TFBS no Liver (HepG2) 40688190 4963 21758977
chr17 40682722 40683286 ZNF274 ENCODE Uniform TFBS no Liver (HepG2) 40688190 4904 21758978
chr17 40682809 40683199 ZNF274 ENCODE Uniform TFBS no Liver (HepG2) 40688190 4991 21758980
chr17 40682850 40683250 ZNF274 ENCODE Uniform TFBS no Liver (HepG2) 40688190 4940 21758983
chr17 40689876 40689891 FOXP1 JASPAR yes 40688190 1686 21240673
chr17 40689877 40689883 TBP TRANSFAC yes 40688190 1687 21240674
chr17 40689877 40689892 FOXP1 JASPAR yes 40688190 1687 21240675
chr17 40689877 40689898 IRF1 JASPAR yes 40688190 1687 21240676
chr17 40689878 40689893 FOXP1 JASPAR yes 40688190 1688 21240677
chr17 40689878 40689899 IRF1 JASPAR yes 40688190 1688 21240678
chr17 40689879 40689894 FOXP1 JASPAR yes 40688190 1689 21240679
chr17 40689879 40689900 IRF1 JASPAR yes 40688190 1689 21240680
chr17 40689880 40689895 FOXP1 JASPAR yes 40688190 1690 21240681
chr17 40689880 40689901 IRF1 JASPAR yes 40688190 1690 21240682
chr17 40689881 40689896 FOXP1 JASPAR yes 40688190 1691 21240683
chr17 40689882 40689897 FOXP1 JASPAR yes 40688190 1692 21240684
chr17 40689882 40689903 IRF1 JASPAR yes 40688190 1692 21240685
chr17 40689883 40689898 FOXP1 JASPAR yes 40688190 1693 21240686
chr17 40689883 40689904 IRF1 JASPAR yes 40688190 1693 21240687
chr17 40689884 40689899 FOXP1 JASPAR yes 40688190 1694 21240688
chr17 40689887 40689901 STAT1 JASPAR yes 40688190 1697 21240689
chr17 40689887 40689902 STAT2 JASPAR yes 40688190 1697 21240690
SNPs associated with NAGLU[ENSG00000108784.5], confirmed by eQTL
Back to top
Chrom. Position dbSNP ID Reference Allele Alternative Allele Distance between TSS and SNP Tissue q Value id More
chr17 40682341 rs4633765 T A 5849 Esophagus 7.65588e-06 4879323
chr17 40615169 rs60922833 CACCGCCGAGCCCGGCTAATTTTTTTTTTCT C 73021 Esophagus 1.38938e-05 4879043
chr17 40270957 rs2074163 G A 417233 Spleen 0.218351 4876623
chr17 39956257 rs150966006 A G 731933 Ovary 0.352539 4875426
chr17 40597555 rs36005199 A G 90635 Lung 1.92766e-07 4878848
Details of NAGLU[ENSG00000108784.5]
Back to top
Genomic Location chr17:40688190-40696467[+]
TSS 40688190
Gene Name NAGLU
Ensembl ID ENSG00000108784.5
ENTREZID 4669
Uniprot
P54802
A0A140VJE4
Protein Name
Alpha-N-acetylglucosaminidase
Expression levels of NAGLU[ENSG00000108784.5]
Back to top