EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr1:12606847-12611860]
Chromosome characteristics of ZBTB33[chr1:12606847-12611860]
Back to top
Enhancers possibly regulated by ZBTB33[chr1:12606847-12611860]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 12597605 12619763 enh11515
Bone Marrow (K562) Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Lung Heart
chr1 12609717 12610039 vista414
VISTA
SNP sites on ZBTB33[chr1:12606847-12611860]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 12606962 rs10779771 G T 86659
chr1 12606975 rs547509653 C T 86660
chr1 12606976 rs192334067 G A 86661
chr1 12606997 rs10864558 G A 86662
chr1 12607007 rs180683739 C G,T 86663
chr1 12607136 rs12568438 G T 86664
chr1 12607152 rs141030948 G A 86665
chr1 12607234 rs574793705 A G 86666
chr1 12607307 rs59109883 G A 86667
chr1 12607374 rs561045673 C T 86668
chr1 12607605 rs540992589 T C 86669
chr1 12607683 rs557801914 A G 86670
chr1 12607717 rs12402970 C T 86671
chr1 12607732 rs148829182 C T 86672
chr1 12607763 rs76247049 G A,C 86673
chr1 12607844 rs574354756 G A 86674
chr1 12608007 rs563036963 C T 86675
chr1 12608165 rs75450598 G C 86676
chr1 12608178 rs6541030 A G 86677
chr1 12608239 rs76099104 C T 86678
chr1 12608240 rs11589918 G A 86679
chr1 12608489 rs67684629 T G 86680
chr1 12608493 rs535803867 G A 86681
chr1 12608506 rs115288244 C T 86682
chr1 12608525 rs556643253 G A 86683
chr1 12608565 rs559094640 C T 86684
chr1 12608578 rs143772953 G A 86685
chr1 12608589 rs562011525 A G 86686
chr1 12608691 rs139268233 A AGAGG 86687
chr1 12608691 rs753087914 A AGAGG 86688
chr1 12608950 rs566989817 G T 86689
chr1 12609086 rs10864559 T C,G 86690
chr1 12609087 rs536658681 G A,T 86691
chr1 12609178 rs116401044 C T 86692
chr1 12609251 rs6687453 G A 86693
chr1 12609268 rs74790186 C G,T 86694
chr1 12609309 rs183815027 G A 86695
chr1 12609348 rs375364852 C G 86696
chr1 12609417 rs375456252 G A 86697
chr1 12609434 rs6541031 C T 86698
chr1 12609466 rs56008580 G A,C 86699
chr1 12609604 rs372798853 G A 86700
chr1 12609621 rs555507503 T C 86701
chr1 12609644 rs78874514 C A,G,T 86702
chr1 12609741 rs6690281 G A 86703
chr1 12609780 rs182104361 G A 86704
chr1 12609796 rs141239856 T A 86705
chr1 12609942 rs531778394 G A 86706
chr1 12609973 rs76589131 A G 86707
chr1 12610062 rs535561810 C T 86708
chr1 12610105 rs150647189 G A 86709
chr1 12610148 rs139728966 A C,G 86710
chr1 12610227 rs398102448 C CT 86711
chr1 12610227 rs70987252 C CT 86712
chr1 12610301 rs573930005 C G 86713
chr1 12610399 rs35146272 A AT,ATT 86714
chr1 12610451 rs12724629 G A 86715
chr1 12610568 rs6693521 G C 86716
chr1 12610585 rs527955667 G A 86717
chr1 12610594 rs112237700 G A,T 86718
chr1 12610648 rs75251070 C T 86719
chr1 12610649 rs568927914 G A 86720
chr1 12610795 rs113501852 T C 86721
chr1 12610810 rs111455886 T C 86722
chr1 12610826 rs112753745 C T 86723
chr1 12610923 rs142388173 T A 86724
chr1 12611023 rs6685683 T G 86725
chr1 12611070 rs77219334 G A 86726
chr1 12611091 rs541747537 A G 86727
chr1 12611180 rs10864560 G A 86728
chr1 12611223 rs369741511 A G 86729
chr1 12611225 rs531408550 T G 86730
chr1 12611230 rs372058742 C T 86731
chr1 12611231 rs12410652 T A,G 86732
chr1 12611235 rs375314044 TC T 86733
chr1 12611327 rs151169854 C T 86734
chr1 12611365 rs536663593 C A,G 86735
chr1 12611390 rs191416812 C T 86736
chr1 12611430 rs183896698 C T 86737
chr1 12611455 rs140152356 G A 86738
chr1 12611466 rs10864561 T A 86739
chr1 12611483 rs10864562 G A 86740
chr1 12611561 rs549871057 CAAAA C 86741
chr1 12611561 rs571308260 C CA 86742
chr1 12611600 rs112567076 A C 86743
chr1 12611629 rs11121924 A G 86744
chr1 12611674 rs77572097 C A,T 86745
chr1 12611759 rs564780703 G C 86746
chr1 12611776 rs190027312 C T 86747
chr1 12611780 rs538847683 GGGCAATGGGGAGCCATTGAA G 86748
chr1 12611852 rs12062307 C T 86749
Genes possibly regulated by ZBTB33[chr1:12606847-12611860]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr1:12606847-12611860]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results