EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr2:232476928-232480423]
Chromosome characteristics of POLR2A[chr2:232476928-232480423]
Back to top
Enhancers possibly regulated by POLR2A[chr2:232476928-232480423]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 232460065 232495135 enh6201
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Brain (SK-N-SH) Ovary Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
chr2 232478392 232478857 vista35160
VISTA
chr2 232478879 232479328 vista35161
VISTA
chr2 232479434 232479727 vista35162
VISTA
SNP sites on POLR2A[chr2:232476928-232480423]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 232476936 rs561360148 G C 6436118
chr2 232477063 rs1865374 G C 6436119
chr2 232477192 rs569170866 C T 6436120
chr2 232477212 rs56776818 A G 6436121
chr2 232477319 rs184414629 T A 6436122
chr2 232477427 rs187224694 G T 6436123
chr2 232477486 rs377712745 AC A 6436124
chr2 232477486 rs529197761 AC A 6436125
chr2 232477489 rs35916210 A AC,ACC 6436126
chr2 232477489 rs397988208 A AC 6436127
chr2 232477495 rs575520910 C A,G,T 6436128
chr2 232477499 rs74753343 C A 6436129
chr2 232477638 rs138313536 G C,T 6436130
chr2 232477777 rs74664808 G A 6436131
chr2 232477779 rs149641824 G A 6436132
chr2 232477858 rs140804946 T TC 6436133
chr2 232477858 rs554398669 T TC 6436134
chr2 232477902 rs529996134 A G 6436135
chr2 232477970 rs548157621 T C 6436136
chr2 232478029 rs77901874 C G 6436137
chr2 232478205 rs549347140 G A 6436138
chr2 232478721 rs13405161 C A 6436139
chr2 232478748 rs75450490 C A 6436140
chr2 232478776 rs577698323 T TC 6436141
chr2 232478839 rs145963129 C T 6436142
chr2 232478846 rs58205528 C T 6436143
chr2 232478868 rs13031890 G A 6436144
chr2 232478874 rs60370474 G C 6436145
chr2 232478939 rs71056220 A AT 6436146
chr2 232478969 rs112760387 G A 6436147
chr2 232478974 rs59513960 G A 6436148
chr2 232478995 rs556654505 G A 6436149
chr2 232479021 rs541854450 T C,G 6436150
chr2 232479106 rs546104024 G A 6436151
chr2 232479133 rs199836086 GCC G 6436152
chr2 232479140 rs184582720 C T 6436153
chr2 232479186 rs531365790 C A 6436154
chr2 232479234 rs78127068 G T 6436155
chr2 232479239 rs1369067 A G 6436156
chr2 232479295 rs1347344 G A 6436157
chr2 232479387 rs74620949 C T 6436158
chr2 232479411 rs538395535 G A 6436159
chr2 232479422 rs533505804 C CA 6436160
chr2 232479479 rs1529807 A G 6436161
chr2 232479528 rs34597622 C CCG 6436162
chr2 232479528 rs4017896 C CCG 6436163
chr2 232479544 rs572373800 A G 6436164
chr2 232479562 rs1529808 G T 6436165
chr2 232479621 rs1529809 C A 6436166
chr2 232479739 rs79916941 G T 6436167
chr2 232479887 rs73097930 G A 6436168
chr2 232479930 rs534301125 G GGGGCCTCCCAGCTATA,GGGGCCTCCCAGCTATTGCCTGGCGGCCTCCCA 6436169
chr2 232480009 rs1529810 A T 6436170
chr2 232480150 rs536977977 G A 6436171
chr2 232480155 rs555396651 A G 6436172
chr2 232480253 rs75499137 G C 6436173
chr2 232480411 rs142043805 A C 6436174
Genes possibly regulated by POLR2A[chr2:232476928-232480423]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr2:232476928-232480423]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results